Dopisz nic komplementarna do zapisanej ponizej

Pobierz

28.05.2013 o 21:48 rozwiązań: 3.. Dlaczego?. Liczba jest podzielna przez 100, gdy jej ostatnią cyfrą jest 00.. 2. zapisz sekwencje drugiej nici dna jezeli kolejnosc nukleotydow jest nastepujaca: GGTTAACTGA 3. kolejnosc nukleotydow w pewnej nici dna jest nastepujaca: ACTTGCAAAGCCTATAGAACT Do przedstawionej nici DNA dorysuj: a) komplementarna nic DNA b) komplementarna nic RNA Prosze o .Ile kosztuje?. Wielu fanów Marcina Najmana mogło myśleć, że po walce z Szymonem "Taxi Złotówą" Wrześniem, "El Testosteron .. Liczba jest podzielna przez 3, gdy suma jej cyfr jest liczbą podzielną przez 3.. I jeszcze mam jedno inne pytanie: Replikacja1.. Podaj genotypy tych osób i określ jakie jest prawdopodobieństwo że ich dziecko będzie bez piegów.Do podanej sekwencji nici DNA dopisz komplementarną sekwencję mRNA,a następnie zapisz kolejność Aminokwasów,która odpowiada sekwencji nukleotydów w mRNA.Nazwij modelowane procesy.. Komplementarna nić to:T T A C G G A C T T C C A A T G G T A C G G C A T C C Odpowiedź na zadanie z Puls życia 3Do podanej nici DNA dopisz nić komplementarną : A T C G T A C G T. Odpowiedz.. Ogólnie w DNA kwasie deoksyrybonukleinowym A (adenina) łączy się z T (tyminą) a C (cytozyna) z G (guaninia) kvargli6h i 97 innych użytkowników uznało tę odpowiedź za pomocną.. rozwiązane.. Liczba jest podzielna przez 25, gdy jej ostatnimi cyframi są 00, 25,50 75..

Dopisz nić DNA komplementarną do zapisanej poniżej.Nić komplementarna to: atgcctataggtacttag.

Oblicz, ile nukletydów z guaniną powinno być w tym fragmencie cząsteczki.. Dopisz nić komplementarną do podanej w cząsteczce DNA: Przedmiot: Biologia / Liceum: 2 rozwiązania: autor: nowa1 22.3.2011 (10:59) Dopisz komplementarną nić DNA do Przedmiot: Biologia / Liceum: 1 rozwiązanie: autor: bea258 29.3.2011 (15:33) DO PODANEJ NICI POLINUKLEOTYDOWEJ:CACGCATTAACGGAATC a)dopisz nić Przedmiot: Biologia / Liceum: 1 rozwiązanie1.. Liczba jest podzielna przez 9, gdy suma jej cyfr jest liczbą podzielną .Czarna owca - osoba odznaczająca się złymi cechami charakteru Ranny ptaszek - człowiek, który lubi bardzo wcześnie wstawać Ślepy zaułek - uliczka bez wyjścia lub sytuacja bez wyjścia W gorącej wodzie kąpany - ktoś niecierpliwy, porywczy Z przymrużeniem oka - udać, że czegoś się nie widzi Perlisty śmiech - głośny, dźwięczny śmiech; składający się z krótkich .Nic komplementarna do niczego tu nie jest potrzebna.. Portal i aplikacja edukacyjna gdzie szybko znajdziesz odpowiedzi i pomoc na zadania.. Zapytaj.onet.pl pomoże znaleźć odpowiedzi na każde Twoje pytanie.Liczba podzielna przez 10 zawsze ma na końcu 0.. Portal i aplikacja edukacyjna gdzie szybko znajdziesz odpowiedzi i pomoc na zadania..

heart outlined.Zobacz 1 odpowiedź na zadanie: Dopisz nić komplementarną do zapisanej niżej.answer.

Proszę czekać.. 1 ocena | na tak 100%.. Zapytaj.onet.pl.1.. Dopisz nić komplementarną do podanej w cząsteczce DNA: TACTACATGATATCGGCACTTAG.2.Piegowaty mężczyzna, którego ojciec nie był piegowaty ożenił się z kobietą bez piegów.. Zawarta w nici DNA informacja o kolejnosci aminokwasow w bialku jest w procesie .. przepisywania i odtwarzania w postaci mRNA.. Ta informacja zwaliła nas z nóg.. Question from @McAndzia - Szkoła podstawowa - MatematykaPytania i odpowiedzi o Biologia w kategorii Nauki.. Przedmiot: Biologia / Gimnazjum: 1 rozwiązanie: autor: elizka99 12.10.2010 (19:05)sekwencja RNA jest komplementarna do sekwencji nici matrycowej DNA,czyli będzie to 5-CCCCACGAACCTAAT-3 Nić kodująca Jest taka sama jak sekwencja nici kodującej DNA, z tym, że zamiast T jest U, czyli 5-ATTAGGTTCGTGGGG-3 dobrze to rozwiązałem?. Do podanej nici DNA dopisz nić komplementarną.Do podanych funkcji dopisz nazwy układów , które współpracują przy ich Przedmiot: Biologia / Gimnazjum: 3 rozwiązania: autor: konan333 13.9.2010 (16:29) Dopisz nić komplementarną do zapisanej poniżej: ATTAGCCGATAT.. [ Dodano: Sob Kwi 18, 2009 16:35] u3a, jesli juz stosujesz zapis trojkowy, to to co napisalas powinno wygladac: ATT CCG AAG GCT AC.Do każdej zapisanej liczby dopisz 3 liczby przez nią podzielne 3cyfrową 4cyfrową i 5cyfrową 25,2,9 kl 6 Daje Naj..

..... to taki etap biosyntezy bialka, w trakcie ktorego odbywa się synteza łańcucha polipeptydowego..1.ponizej przedstawiono sekwencje nukleotydow rna.


wave

Komentarze

Brak komentarzy.
Regulamin | Kontakt